This doesn't really have much to do with biology, except that many purveyors of Intelligent Design are also partisans in the made-up War on Christmas (a feint by right-wingers who know they are losing their War on Pluarlity and Tolerance). The latest example of this is in NY Times columnist Maureen Dowd's Christmas Eve column, which was actually written by her right-wing brother Kevin. He goes off on 'Happy Holidays', Tookie Williams, Michael Moore, the War in Iraq, and of course, Judge Jones and intelligent design. There seems to be no coherent intellectual common denominator underlying all of this except the idea that Liberals are plotting to destroy good ol' Christian America. I'd think that Kevin Dowd was nuttier than a jar of Jiff, if it weren't for the fact that many people very dear to me also share these beliefs to the letter, and I know this comes from a deeply felt frustration.
People like Kevin label non-believers like me as the ten percent of the American population who "don't believe anything at all." Let's leave aside the fact that I'd rather not "believe in anything at all" than buy into the mindless demagoguery echoed by people who let Bill O'Reilly do their thinking for them; here's what I as a non-believer believe about Jesus and Christmas:
I don't worship Jesus, I don't believe in him as my savior, and I don't believe he came to this world to warn us all not to get Left Behind. As beautiful as I find the Hallelujah chorus, I do not believe that "the kingdom of this world [will] become the kingdom of our Lord and of his Christ, and he shall reign for ever and ever" as "King of Kings and Lord of Lords." Nor do I think he was the one greatest philosopher or wise man in history.
I do love Jesus though - the Jesus of the Synoptic Gospels, the Jesus who stands up to the religious hard-liners of his day, the Jesus who deflates the pretensions of the Pharisees by associating with the 'unclean' of society, the Jesus who said "there is nothing outside a person that by going in can defile, but the things that come out are what defile," the Jesus who chastised those who exploit the sacred for profit by making a house of prayer a den of robbers. The parable of the Good Samaritan resonates with my evolutionary belief in the universal kinship of all people and all life.
What message is more important to this world today - in an Iraq devastated by neo-Conservative machinations to make over the Middle East, as well as the inane jihad by cold-blooded Islamic terrorists (non-combatant civilian deaths equaling more than 40 9-11's), in a Sudan stained by genocide, in a Europe fractured by ethnic strife, and in an America which watched the poor, black, and sick of New Orleans drown while the white suburbanites got out - what message is more important? That Jesus died for your sins and that you too can go to heaven if you just accept his grace (and if you don't you'll burn in hell)? Or that we should not judge, "and you will not be judged; do not condemn, and you will not be condemned. Forgive, and you will be forgiven; give, and it will be given unto you. A good measure, pressed down, shaken together, running over, will be put into your lap; for the measure you give will be the measure you give back."
There has never been a better statement of the Golden Rule; that's this non-believer's take on Christmas and why I believe in it, so to Kevin Dowd and everyone else,
Merry Christmas.
Saturday, December 24, 2005
Thursday, December 22, 2005
The Dog Genome - part 1 Why sequence genomes?
I was excited to see the paper on the dog genome in the Dec. 8 issue of Nature. These genome papers offer so many interesting insights about many different aspects of biology - in fact, genome sequencing touches on so many different fields that it's worth reviewing why we sequence genomes. Genome sequencing is a resource-intensive effort, so it's important to understand why this effort is justified.
Molecular Biology: Molecular biologists have long sought to understand the structure and function of the molecular parts of the cell. Like physiologists who study whole organisms, molecular biologists want to know what everything in the cell does. Ideally, we would like to determine the function(s) of every protein made in an organism, the 3-D structure of each of these proteins, the conditions under which these proteins are expressed, how they interact with each other and the non-protein parts of the cell, which portions of our DNA contain regulatory sequences that control gene expression and how those sequences work, etc. etc. In other words, we want to a complete mechanistic picture of the cell.
To even come close to this goal, we must know the DNA sequence of the genome, because every protein and RNA component of the cell is coded by our DNA. By having a genome sequence, we basically have a complete parts list for the cell, even if we don't completely know how to read that list yet. With this parts list, one can make a complete collection of protein-coding genes in an experimentally useful form, and then study those genes systematically. (In a shameless act of self-promotion, I recommend you check out this relevant abstract recently published by our group.) This type of approach has been extensively used in yeast, but can also work for human genes. Another application is the creation of DNA chips, or microarrays, which have been tremendously useful in recent years. Without genome sequences, we could not build these collections and perform such genome-wide experiments.
An advantage of sequencing multiple mammalian genomes (human, chimp, mouse, rat, and now dog), is that we can compare them. This is useful for evolutionary studies (which I'll get to in the next post), but it is also crucial for those purely interested in mechanistic molecular biology. Identifying functionally important portions of a single genome is extremely difficult. Even protein-coding genes are hard to identify. Protein coding genes start with the DNA sequence ATG and end with TAG, TAA, or TGA, with a stretch of DNA in between coding for the amino acids of the protein, like this gene for the human cannabinoid receptor-1, which is the receptor acted on by the major active component of marijuana:
ATGAAGTCGATCCTAGATGGCCTTGCAGATAC
CACCTTCCGCACCATCACCACTGACCTCCTGTACGTGGG
CTCAAATGACATTCAGTACGAAGACATCAAAGGTGACAT
GGCATCCAAATTAGGGTACTTCCCACAGAAATTCCCTTT
AACTTCCTTTAGGGGAAGTCCCTTCCAAGAGAAGATGAC
TGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGT
GAACATTACAGAATTTTACAACAAGTCTCTCTCGTCCTTC
AAGGAGAATGAGGAGAACATCCAGTGTGGGGAGAACTTC
ATGGACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAG
CAGCTGGCCATTGCAGTCCTGTCCCTCACGCTGGGCACC
TTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTCATC
CTCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTACCAC
TTCATCGGCAGCCTGGCGGTGGCAGACCTCCTGGGGAGT
GTCATTTTTGTCTACAGCTTCATTGACTTCCACGTGTTCC
ACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGG
GTGGGGTCACGGCCTCCTTCACTGCCTCCGTGGGCAGCC
TGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAG
GCCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGC
CGTGGTGGCGTTTTGCCTGATGTGGACCATAGCCATTGTG
ATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAAC
TGCAATCTGTTTGCTCAGACATTTTCCCACACATTGATGAA
ACCTACCTGATGTTCTGGATCGGGGTCACCAGCGTACTGCT
TCTGTTCATCGTGTATGCGTACATGTATATTCTCTGGAAGG
CTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACCCAG
AAGAGCATCATCATCCACACGTCTGAGGATGGGAAGGTACA
GGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAG
CCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCT
GGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGA
AGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTA
TGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATG
CTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGT
TTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCA
TGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAG
CCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGG
TCAAGATTGCCAAGGTAACCATGTCTGTGTCCACAGACACGT
CTGCCGAGGCTCTGTGA
The hard part is that not all DNA sequences that fit those criteria are actually protein coding genes - some DNA sequences look like protein coding genes, but they really aren't.
Furthermore, functionally important DNA sequences that do not code for proteins don't start with ATG and end with TAG, TAA or TGA. We can't identify these sites by just looking for certain features in a single genome. This is where genome sequencing is useful - to identify functionally important portions of our genome, whether they code for protein or not, we can compare genomes of related organisms at various evolutionary distances from ours. Because of evolution, genomes change; those parts that are not functionally important can usually change without adverse consequences for the fitness of the organism, while the parts that are functionally important will generally be constrained. So you can compare genomes of various organisms and look for those parts that haven't changed very much; this is a major clue that these parts are authentic functional sequences. If a DNA sequence starts with ATG and ends with TGA, but is poorly conserved among different species, this may not be a true protein coding gene. (On the other hand, it could be a rapidly evolving gene involved in a function like reproduction or the immune system; there are way to test for this.) If a non-coding DNA sequence close to a protein-coding gene is very similar among different species, this sequence could be involved in regulating the nearby protein-coding gene. (Keep in mind, I'm really simplifying things, but this is the basic idea behind comparative genomics.) This is illustrated in the following schematic:

Potential protein-coding genes start with ATG and and with TGA; the blue gene is conserved between human and mouse, while the green gene is not. The blue gene is probably an authentic protein-coding gene, while the green one may not be. The red sequence is not a protein coding sequence, but it is conserved between mouse and human, thus it may be functionally important.
One important problem is choosing the right organisms. Let's say that we're comparing the chimp genome with the human genome and we find a region of DNA that is very similar in the two genomes. It's possible that this region is similar because it is functionally important, or it could be that this region simply hasn't changed much yet because humans and chimps diverged so recently (on an evolutionary scale - 5-6 million years ago). To resolve this issue, we look at the genomes of other organisms, such the mouse or dog. The human and dog genomes diverged much farther back in time, so DNA sequences that are conserved among these two genomes are very likely to be functionally relevant. (On the other hand, the human and dog lineages have diverged enough that some functionally important sequences may not be that similar, which is why we look at an intermediate genome, like mouse or rat.)
This kind of comparison has been very useful in yeast (check out this paper and this one), helping researchers to better define protein-coding genes and non-coding regulatory elements. With this knowledge, we can focus our experimental efforts on systematically characterizing these genomic elements.
In a nutshell, this is one rationale for sequencing genomes. In the next installment, I'll talk about how genomes help us understand evolution, and why the dog genome in particular is useful for studying mammalian evolution.
Molecular Biology: Molecular biologists have long sought to understand the structure and function of the molecular parts of the cell. Like physiologists who study whole organisms, molecular biologists want to know what everything in the cell does. Ideally, we would like to determine the function(s) of every protein made in an organism, the 3-D structure of each of these proteins, the conditions under which these proteins are expressed, how they interact with each other and the non-protein parts of the cell, which portions of our DNA contain regulatory sequences that control gene expression and how those sequences work, etc. etc. In other words, we want to a complete mechanistic picture of the cell.
To even come close to this goal, we must know the DNA sequence of the genome, because every protein and RNA component of the cell is coded by our DNA. By having a genome sequence, we basically have a complete parts list for the cell, even if we don't completely know how to read that list yet. With this parts list, one can make a complete collection of protein-coding genes in an experimentally useful form, and then study those genes systematically. (In a shameless act of self-promotion, I recommend you check out this relevant abstract recently published by our group.) This type of approach has been extensively used in yeast, but can also work for human genes. Another application is the creation of DNA chips, or microarrays, which have been tremendously useful in recent years. Without genome sequences, we could not build these collections and perform such genome-wide experiments.
An advantage of sequencing multiple mammalian genomes (human, chimp, mouse, rat, and now dog), is that we can compare them. This is useful for evolutionary studies (which I'll get to in the next post), but it is also crucial for those purely interested in mechanistic molecular biology. Identifying functionally important portions of a single genome is extremely difficult. Even protein-coding genes are hard to identify. Protein coding genes start with the DNA sequence ATG and end with TAG, TAA, or TGA, with a stretch of DNA in between coding for the amino acids of the protein, like this gene for the human cannabinoid receptor-1, which is the receptor acted on by the major active component of marijuana:
ATGAAGTCGATCCTAGATGGCCTTGCAGATAC
CACCTTCCGCACCATCACCACTGACCTCCTGTACGTGGG
CTCAAATGACATTCAGTACGAAGACATCAAAGGTGACAT
GGCATCCAAATTAGGGTACTTCCCACAGAAATTCCCTTT
AACTTCCTTTAGGGGAAGTCCCTTCCAAGAGAAGATGAC
TGCGGGAGACAACCCCCAGCTAGTCCCAGCAGACCAGGT
GAACATTACAGAATTTTACAACAAGTCTCTCTCGTCCTTC
AAGGAGAATGAGGAGAACATCCAGTGTGGGGAGAACTTC
ATGGACATAGAGTGTTTCATGGTCCTGAACCCCAGCCAG
CAGCTGGCCATTGCAGTCCTGTCCCTCACGCTGGGCACC
TTCACGGTCCTGGAGAACCTCCTGGTGCTGTGCGTCATC
CTCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTACCAC
TTCATCGGCAGCCTGGCGGTGGCAGACCTCCTGGGGAGT
GTCATTTTTGTCTACAGCTTCATTGACTTCCACGTGTTCC
ACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTGG
GTGGGGTCACGGCCTCCTTCACTGCCTCCGTGGGCAGCC
TGTTCCTCACAGCCATCGACAGGTACATATCCATTCACAG
GCCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGC
CGTGGTGGCGTTTTGCCTGATGTGGACCATAGCCATTGTG
ATCGCCGTGCTGCCTCTCCTGGGCTGGAACTGCGAGAAAC
TGCAATCTGTTTGCTCAGACATTTTCCCACACATTGATGAA
ACCTACCTGATGTTCTGGATCGGGGTCACCAGCGTACTGCT
TCTGTTCATCGTGTATGCGTACATGTATATTCTCTGGAAGG
CTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACCCAG
AAGAGCATCATCATCCACACGTCTGAGGATGGGAAGGTACA
GGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAG
CCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCT
GGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGA
AGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTA
TGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATG
CTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGT
TTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCA
TGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAG
CCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGG
TCAAGATTGCCAAGGTAACCATGTCTGTGTCCACAGACACGT
CTGCCGAGGCTCTGTGA
The hard part is that not all DNA sequences that fit those criteria are actually protein coding genes - some DNA sequences look like protein coding genes, but they really aren't.
Furthermore, functionally important DNA sequences that do not code for proteins don't start with ATG and end with TAG, TAA or TGA. We can't identify these sites by just looking for certain features in a single genome. This is where genome sequencing is useful - to identify functionally important portions of our genome, whether they code for protein or not, we can compare genomes of related organisms at various evolutionary distances from ours. Because of evolution, genomes change; those parts that are not functionally important can usually change without adverse consequences for the fitness of the organism, while the parts that are functionally important will generally be constrained. So you can compare genomes of various organisms and look for those parts that haven't changed very much; this is a major clue that these parts are authentic functional sequences. If a DNA sequence starts with ATG and ends with TGA, but is poorly conserved among different species, this may not be a true protein coding gene. (On the other hand, it could be a rapidly evolving gene involved in a function like reproduction or the immune system; there are way to test for this.) If a non-coding DNA sequence close to a protein-coding gene is very similar among different species, this sequence could be involved in regulating the nearby protein-coding gene. (Keep in mind, I'm really simplifying things, but this is the basic idea behind comparative genomics.) This is illustrated in the following schematic:

Potential protein-coding genes start with ATG and and with TGA; the blue gene is conserved between human and mouse, while the green gene is not. The blue gene is probably an authentic protein-coding gene, while the green one may not be. The red sequence is not a protein coding sequence, but it is conserved between mouse and human, thus it may be functionally important.
One important problem is choosing the right organisms. Let's say that we're comparing the chimp genome with the human genome and we find a region of DNA that is very similar in the two genomes. It's possible that this region is similar because it is functionally important, or it could be that this region simply hasn't changed much yet because humans and chimps diverged so recently (on an evolutionary scale - 5-6 million years ago). To resolve this issue, we look at the genomes of other organisms, such the mouse or dog. The human and dog genomes diverged much farther back in time, so DNA sequences that are conserved among these two genomes are very likely to be functionally relevant. (On the other hand, the human and dog lineages have diverged enough that some functionally important sequences may not be that similar, which is why we look at an intermediate genome, like mouse or rat.)
This kind of comparison has been very useful in yeast (check out this paper and this one), helping researchers to better define protein-coding genes and non-coding regulatory elements. With this knowledge, we can focus our experimental efforts on systematically characterizing these genomic elements.
In a nutshell, this is one rationale for sequencing genomes. In the next installment, I'll talk about how genomes help us understand evolution, and why the dog genome in particular is useful for studying mammalian evolution.
Bad Faith
Federal Judge John Jones has ruled, the old school board in Dover has been voted out, and the town can try to get back to normal. According to a story in The New York Times, many Dover residents are agreeing to disagree: "We're not walking around glaring at each other. We just have different political views on this," stated one resident. A Dover high school student: "We said to one another, 'Let's not let this divide our friendship.'"
Is this an issue where reasonable people can agree to disagree? This issue is over whether intelligent design should be taught as science in public school science classes, and this is absolutely not a situation where two reasonable sides can disagree in good faith. Those who argue that Intelligent Design is scientific and should be taught are badly uninformed, every single one of them, about what modern evolutionary biology actually is. Judge Jones found that the school board members who pushed for Dover's intelligent design policy could not even coherently explain what intelligent design was. As the Judge stated in his opinion:
"Furthermore, Board members somewhat candidly conceded that they lacked sufficient background in science to evaluate ID, and several of them testified with equal frankness that they failed to understand the substance of the curriculum change..." (p. 121)
These board members testified that they hardly looked at the ID book at issue Of Pandas and People, and they testified that they did not "know much about intelligent design." Yet they adopted the curriculum change anyway, over the objection of the science faculty in the district, believing that it would enhance critical thinking. As the Judge also pointed out, Board members lied under oath to conceal their religious motivation for the change. Is this how reasonable people, who can reasonably disagree, behave?
How about the Intelligent Design professionals - people like Michael Behe who are supported by the Discovery Institute? While they may be experts on Intelligent Design, time and again they have demonstrated they they are uninformed about the most basic aspects of the theory they claim to be astutely criticizing. William Dembski is a mathematician and philosopher with no biology training whose arguments frequently demonstrate a misunderstanding of basic evolution; Jonathan Wells has a PhD in biology which he obtained in order to "destroy Darwinism", but he wrote a book, Icons of Evolution which contains misunderstandings that a sophomore biology major studying evolution would find obvious (see this critique of Wells's book); Michael Behe is a biochemist with little formal training in evolution, who allowed himself to be listed as both an author and reviewer of Pandas even though he admitted the book has some serious errors regarding the predictions of evolutionary theory. Yet when asked by the plaintiff's attorney to explain the nature of the errors in the book, Behe's response was the absolutely false statement that evolution doesn't make any predictions.
If you are a reasonable person serious about a critique of evolution, you have to understand it before you debunk it, otherwise you're attacking a straw man.
On one side of this issue, the people of Dover (and all over this country) are acting in bad faith - they are not disagreeing over something reasonable people disagree over. Most of them can't define what intelligent design is, yet, while conceding their ignorance on the issue, insist that it is a valid scientific alternative to evolution. That's bad faith. Most of these same people defend the teaching of intelligent design in religious terms - as Judge Jones pointed out, the vast majority of letters to the local papers discussed this issue in religious terms. "Children should not be taught that we came from monkeys when that's flat-out not true," stated one Dover mother to The New York Times. She could not possibly have any basis other than her religious beliefs for denying the common ancestry of humans and apes. In other words, these people want the teaching of evolution balanced with a doctrine they know to be religious in a science class composed of students who don't all share that religious outlook. That's bad faith.
One side can be just plain wrong. And as demonstrated by Judge Jones, a political friend of Republicans Tom Ridge and Rick Santorum, a George W. Bush judicial appointee who attends a Lutheran church with his wife, reasonable Christian Republicans can only come to one reasonable conclusion - in science class, ID cannot masquerade as science.
Is this an issue where reasonable people can agree to disagree? This issue is over whether intelligent design should be taught as science in public school science classes, and this is absolutely not a situation where two reasonable sides can disagree in good faith. Those who argue that Intelligent Design is scientific and should be taught are badly uninformed, every single one of them, about what modern evolutionary biology actually is. Judge Jones found that the school board members who pushed for Dover's intelligent design policy could not even coherently explain what intelligent design was. As the Judge stated in his opinion:
"Furthermore, Board members somewhat candidly conceded that they lacked sufficient background in science to evaluate ID, and several of them testified with equal frankness that they failed to understand the substance of the curriculum change..." (p. 121)
These board members testified that they hardly looked at the ID book at issue Of Pandas and People, and they testified that they did not "know much about intelligent design." Yet they adopted the curriculum change anyway, over the objection of the science faculty in the district, believing that it would enhance critical thinking. As the Judge also pointed out, Board members lied under oath to conceal their religious motivation for the change. Is this how reasonable people, who can reasonably disagree, behave?
How about the Intelligent Design professionals - people like Michael Behe who are supported by the Discovery Institute? While they may be experts on Intelligent Design, time and again they have demonstrated they they are uninformed about the most basic aspects of the theory they claim to be astutely criticizing. William Dembski is a mathematician and philosopher with no biology training whose arguments frequently demonstrate a misunderstanding of basic evolution; Jonathan Wells has a PhD in biology which he obtained in order to "destroy Darwinism", but he wrote a book, Icons of Evolution which contains misunderstandings that a sophomore biology major studying evolution would find obvious (see this critique of Wells's book); Michael Behe is a biochemist with little formal training in evolution, who allowed himself to be listed as both an author and reviewer of Pandas even though he admitted the book has some serious errors regarding the predictions of evolutionary theory. Yet when asked by the plaintiff's attorney to explain the nature of the errors in the book, Behe's response was the absolutely false statement that evolution doesn't make any predictions.
If you are a reasonable person serious about a critique of evolution, you have to understand it before you debunk it, otherwise you're attacking a straw man.
On one side of this issue, the people of Dover (and all over this country) are acting in bad faith - they are not disagreeing over something reasonable people disagree over. Most of them can't define what intelligent design is, yet, while conceding their ignorance on the issue, insist that it is a valid scientific alternative to evolution. That's bad faith. Most of these same people defend the teaching of intelligent design in religious terms - as Judge Jones pointed out, the vast majority of letters to the local papers discussed this issue in religious terms. "Children should not be taught that we came from monkeys when that's flat-out not true," stated one Dover mother to The New York Times. She could not possibly have any basis other than her religious beliefs for denying the common ancestry of humans and apes. In other words, these people want the teaching of evolution balanced with a doctrine they know to be religious in a science class composed of students who don't all share that religious outlook. That's bad faith.
One side can be just plain wrong. And as demonstrated by Judge Jones, a political friend of Republicans Tom Ridge and Rick Santorum, a George W. Bush judicial appointee who attends a Lutheran church with his wife, reasonable Christian Republicans can only come to one reasonable conclusion - in science class, ID cannot masquerade as science.
Wednesday, December 21, 2005
Washington Post on the Dover Ruling
The Wasghinton post has this analysis of yesterday's ruling against ID in the Dover, PA school district. (Free registration required.)
The article is trying to get at the basic points of Judge Jones' arguments, but I think the article is flawed in several respects.
First, the article is titled "Defending Science by Defining It," which suggests that Intelligent Design advocates are right when they say that evolution's defenders arbitrarily and illogically exclude ID from science by definition. This is not true - scientists do not arbitrarily exclude supernatural causation; this is a deliberate step initially taken by scientists hundreds of years ago, and it has proven fantastically successful. By asking scientists to include supernatural explanations in science, ID advocates are asking scientists to abandon a method that has succeeded extremely well for centuries; furthermore, by simply chalking up some phenomenon to an unexplained supernatural cause you essentially close off any motivation for further inquiry and will miss natural explanations that may be just beyond the horizon.
This is why it is so important in these cases to explain how science works, to define science, in order to show that ID fails as science. On the other hand, to tell someone that 'you're defending your position just by defining it so as to exclude an alternative position' (as the Post title hints at) is to suggest that someone really can't back up their position with arguments. That's not what's happening in Judge Jones' ruling.
The second major beef I have with this article is this phrase:
"When evolution's defenders find themselves tongue-tied and seemingly bested by neo-creationists -- when they believe they have the facts on their side but do not know where to find them -- this 139-page document may be the thing they turn to." (Meaning, that 139-page document that defends science by merely defining it?)
The only public setting were evolution's defender's are sometimes tongue-tied before neo-creationists is in staged debates in front of predominantly conservative Christian audiences that place a premium on rhetorical skill as opposed to thorough logic. In the literature, on the internet, in court, and in public school board meetings, evolution's defenders are not tongue-tied or missing facts. Anyone who has spent much time on this issue knows that a huge source of facts is at Talk Origins and NCSE; discussion and expertise can be found on The Panda's Thumb; there are huge written resources including excellent articles by evolutionary biologists Jerry Coyne (a New Republic Article) and H. Allen Orr (in The New Yorker), and many, many good books (I'm naming just a few of my favorites): Abusing Science, Tower of Babel, Intelligent Design and It's Critics, Scientists Confront Creationism, God, The Devil, and Darwin, Finding Darwin's God, What Evolution Is, Science as a Way of Knowing, the free book Science and Creationism from the National Academy. Those of us who work in the relevant fields turn to the research literature when we're looking for facts.
(If you're interested in reading what ID advocates have written, their most cited books are Darwin's Black Box, Darwin on Trial, Icons of Evolution, The Design Inference, and No Free Lunch; other representative books are Uncommon Dissent, The Design Revolution, and Mere Creation. If it looks like this list is slanted towards William Dembski, that's because he's by far the most prolific ID advocate.)
Given this body of work, why on earth did the Post writers suggest that tongue-tied evolution defenders finally have something to turn to now that the decision is out? Don't get me wrong, I am thrilled with the decision, but the Post article is just bizarre.
Furthermore, the article doesn't always connect logically:
"By contrast, intelligent design's views on how the world got to be the way it is offer no testable facts, choosing instead to rely on authoritative statements. Adherents posit, for example, that animals were abruptly created (many in the same form in which they exist today) by a supernatural designer."
I agree with the characterization of ID in the first sentence, but that first sentence is not really logically supported by the second, as it stands. You would have to point out that ID adherents accept abrupt creation of animals by appealing to authority (the Bible), or explain exactly why positing a supernatural designer is not testable.
This article aimed to analyze the decision in an unbiased way, but it just isn't thought through very well. I'm disappointed in the Post.
The article is trying to get at the basic points of Judge Jones' arguments, but I think the article is flawed in several respects.
First, the article is titled "Defending Science by Defining It," which suggests that Intelligent Design advocates are right when they say that evolution's defenders arbitrarily and illogically exclude ID from science by definition. This is not true - scientists do not arbitrarily exclude supernatural causation; this is a deliberate step initially taken by scientists hundreds of years ago, and it has proven fantastically successful. By asking scientists to include supernatural explanations in science, ID advocates are asking scientists to abandon a method that has succeeded extremely well for centuries; furthermore, by simply chalking up some phenomenon to an unexplained supernatural cause you essentially close off any motivation for further inquiry and will miss natural explanations that may be just beyond the horizon.
This is why it is so important in these cases to explain how science works, to define science, in order to show that ID fails as science. On the other hand, to tell someone that 'you're defending your position just by defining it so as to exclude an alternative position' (as the Post title hints at) is to suggest that someone really can't back up their position with arguments. That's not what's happening in Judge Jones' ruling.
The second major beef I have with this article is this phrase:
"When evolution's defenders find themselves tongue-tied and seemingly bested by neo-creationists -- when they believe they have the facts on their side but do not know where to find them -- this 139-page document may be the thing they turn to." (Meaning, that 139-page document that defends science by merely defining it?)
The only public setting were evolution's defender's are sometimes tongue-tied before neo-creationists is in staged debates in front of predominantly conservative Christian audiences that place a premium on rhetorical skill as opposed to thorough logic. In the literature, on the internet, in court, and in public school board meetings, evolution's defenders are not tongue-tied or missing facts. Anyone who has spent much time on this issue knows that a huge source of facts is at Talk Origins and NCSE; discussion and expertise can be found on The Panda's Thumb; there are huge written resources including excellent articles by evolutionary biologists Jerry Coyne (a New Republic Article) and H. Allen Orr (in The New Yorker), and many, many good books (I'm naming just a few of my favorites): Abusing Science, Tower of Babel, Intelligent Design and It's Critics, Scientists Confront Creationism, God, The Devil, and Darwin, Finding Darwin's God, What Evolution Is, Science as a Way of Knowing, the free book Science and Creationism from the National Academy. Those of us who work in the relevant fields turn to the research literature when we're looking for facts.
(If you're interested in reading what ID advocates have written, their most cited books are Darwin's Black Box, Darwin on Trial, Icons of Evolution, The Design Inference, and No Free Lunch; other representative books are Uncommon Dissent, The Design Revolution, and Mere Creation. If it looks like this list is slanted towards William Dembski, that's because he's by far the most prolific ID advocate.)
Given this body of work, why on earth did the Post writers suggest that tongue-tied evolution defenders finally have something to turn to now that the decision is out? Don't get me wrong, I am thrilled with the decision, but the Post article is just bizarre.
Furthermore, the article doesn't always connect logically:
"By contrast, intelligent design's views on how the world got to be the way it is offer no testable facts, choosing instead to rely on authoritative statements. Adherents posit, for example, that animals were abruptly created (many in the same form in which they exist today) by a supernatural designer."
I agree with the characterization of ID in the first sentence, but that first sentence is not really logically supported by the second, as it stands. You would have to point out that ID adherents accept abrupt creation of animals by appealing to authority (the Bible), or explain exactly why positing a supernatural designer is not testable.
This article aimed to analyze the decision in an unbiased way, but it just isn't thought through very well. I'm disappointed in the Post.
Tuesday, December 20, 2005
Judge rules against ID in Dover
In the Nation's first case over teaching intelligent design (ID) in public schools, a federal judge ruled that ID is not science.
The NY Times article is here.
The decision in PDF format is here, from the ACLU of PA.
The National Center for Science Education site on the case is here.
It's a 139 page decision - most observers expected the judge to rule in favor of the plaintiffs like he did; the only question now is how narrow or broad the ruling is, which will tell us what implications this has for the larger ID movement. A broad decision may finally force the movement to lay off its school curriculum efforts (yeah right, who am I kidding?), and for once start focusing on the science behind ID, which was supposed to come years ago, and which we're still waiting for.
Update: for some in-depth discussion, as well as links to the response by the pro-ID Discovery Institute, take a look at Panda's Thumb.
Another update: nice background on the trial in the eSkeptic newsletter.
The NY Times article is here.
The decision in PDF format is here, from the ACLU of PA.
The National Center for Science Education site on the case is here.
It's a 139 page decision - most observers expected the judge to rule in favor of the plaintiffs like he did; the only question now is how narrow or broad the ruling is, which will tell us what implications this has for the larger ID movement. A broad decision may finally force the movement to lay off its school curriculum efforts (yeah right, who am I kidding?), and for once start focusing on the science behind ID, which was supposed to come years ago, and which we're still waiting for.
Update: for some in-depth discussion, as well as links to the response by the pro-ID Discovery Institute, take a look at Panda's Thumb.
Another update: nice background on the trial in the eSkeptic newsletter.
Monday, December 19, 2005
Dover School Board Intelligent Design Case Decision Tomorrow
Judge Jones is expected to file his decision in the Kitmiller et al. v Dover School Board case some time tomorrow, according to the National Center for Science Education blog. This decision could have major implcations for the legal strategy of the intelligent design movement. Check that site for the latest.
Saturday, December 17, 2005
NY Times on Judge Jones and the Dover, PA Case
Here's a NY Times profile of Judge Jones, the judge in the Dover School Board Intelligent Design case. A ruling is expected in a few days.
Interesting NY Times article on science
Jim Holt has an interesting piece about Americans and science in this weekend's NY Times Magazine. He's commenting on this interesting paradox:
"By many measures, this nation leads the world in scientific research, even if our dominance has been slipping of late. Oddly though, Americans on the whole so not seem to care greatly for science."
Holt writes about various reasons people might have for being uncomfortable with science - conflict with religious views, the difficulty of some scientific concepts, how many of the foundational theories contradict common sense (ie, quantum mechanics), the idea that 'cold' scientific explanations suck the meaning out of nature.
In spite of this ambivalence, a sidebar in the article shows that shows 42% of the public has a great deal of confidence in the scientific community, while only 24% have great confidence in organized religion and only 22% have great confidence in the executive branch of the Federal Government (survey from Jan. 2005).
Holt is touching on an interesting topic - science makes a lot of people nervous, but on the other hand scientists hold great public trust, and continue to produce technological breakthroughs that change our lives. The implications of science may be disturbing for some ideas most of us hold dear, while on the other hand, there has to be something to this science business, since science has a "spectacular ability to make matter and energy jump through hoops on command" (Holt quoting Richard Dawkins).
Does this explain the public's ambivalence towards science? The fruits of scientific progress are undeniable, yet this progress is based on esoteric theories that are difficult to understand, and which seem to leave no room for God or morals.
I'm convinced that if we take away some of the mystery and incomprehensibility through better science literacy, most people will realize that there is plenty of room in a scientific world to keep those things that they find most meaningful in life.
"By many measures, this nation leads the world in scientific research, even if our dominance has been slipping of late. Oddly though, Americans on the whole so not seem to care greatly for science."
Holt writes about various reasons people might have for being uncomfortable with science - conflict with religious views, the difficulty of some scientific concepts, how many of the foundational theories contradict common sense (ie, quantum mechanics), the idea that 'cold' scientific explanations suck the meaning out of nature.
In spite of this ambivalence, a sidebar in the article shows that shows 42% of the public has a great deal of confidence in the scientific community, while only 24% have great confidence in organized religion and only 22% have great confidence in the executive branch of the Federal Government (survey from Jan. 2005).
Holt is touching on an interesting topic - science makes a lot of people nervous, but on the other hand scientists hold great public trust, and continue to produce technological breakthroughs that change our lives. The implications of science may be disturbing for some ideas most of us hold dear, while on the other hand, there has to be something to this science business, since science has a "spectacular ability to make matter and energy jump through hoops on command" (Holt quoting Richard Dawkins).
Does this explain the public's ambivalence towards science? The fruits of scientific progress are undeniable, yet this progress is based on esoteric theories that are difficult to understand, and which seem to leave no room for God or morals.
I'm convinced that if we take away some of the mystery and incomprehensibility through better science literacy, most people will realize that there is plenty of room in a scientific world to keep those things that they find most meaningful in life.
Friday, December 16, 2005
Stay tuned - the dog genome just came out
Last Thursday (Dec. 8) Nature published a report on the sequencing of the dog genome (subscription required but go take a look at the TOC anyway). Genome papers can be really fun to read and full of all sorts of fascinating facts, and I plan on posting on the dog genome this weekend. I'm a week behind since the next issue of Nature is already out, but Dec. 8 was my doctoral defense, so I'm a little backlogged. This blog has been a little too creation/evolution heavy, which was not my intention; there are a lot of real scientific issues out there to discuss. Stay tuned!
Evolutionary biology is not "origins of life" research
One of the major flaws in the arguments of anti-evolution writers is the conflation of the issue of prebiotic or pre-cellular evolution, and modern evolutionary theory. An example can be found in the comments of the creationist-sympathizer Judge Carnes, who demonstrated his complete ignorance of evolutionary biology with the following statement (at the LA Times, also check this post at the Panda's Thumb):
"From nonlife to life is the greatest gap in scientific theory. There is less evidence supporting it than there is for other theories. It sounds to me like evolution is more vulnerable and deserves more critical thinking..."
Leaving aside the fact that it's absurd for someone with no biology training to assume that what he sees as gaps or problems in a complex scientific theory are due to a lack of critical thinking by professional scientists and not his own ignorance, let's focus on this conflation of origins of life research and evolutionary biology, which is one of the most common misconceptions that the public has regarding evolution.
What are the differences between the two scientific fields?
Modern evolutionary biology begins where Darwin began - with the assumption of an already existing population of living cells. It makes no claims about where those first cells came from - how the first proteins came into existence, how the genetic code arose, how transcriptional and translational machinery came into being (the machinery responsible for taking the information from DNA and turning it into protein), how we got information from DNA to RNA to protein, how a metabolism arose, how a cell membrane encapsulated a replicating genome, how phenotype got linked to genotype. All of these are questions that are outstanding in the field of prebiotic evolution, or, if you will, origins of life research. If you take a class in evolutionary biology in college or high school, or read a textbook on evolutionary biology, you do not get taught the modern science of prebiotic evolution. The text may briefly mention some current scientific ideas on the origins of life (it may even include a whole chapter on it), but the textbook does not focus on the detailed content or techniques of that field. Why? Because origins of life research is not the same thing as evolutionary biology, or neo-Darwinism, or whatever you want to call it. As a biologist who is very interested in prebiotic evolution (although I have not yet done research in this field), I have to admit that most of the questions I listed above are still wide open. Scientists aren't completely empty-handed, but the transition from non-life to life is still a big, fascinating scientific question. But this is not true of evolutionary biology.
It is important to note that logically evolutionary biology does not depend on the status of the field of prebiotic evolution. Whether natural selection is a major evolutionary mechanism, whether punctuated equilibrium is correct, whether ideas about genetic drift, speciation, neutral evolution, the molecular clock, or specific phlyogenetic relationships are correct does not at all depend on any conclusions or theories about how the first cells arose. God could have poofed those first cells into existence; it would make no difference. Darwin and every major biologist since then has been clear about this. Asserting that scientists can't explain how the first molecular machines arose does not weaken the status of natural selection or any aspect of modern evolutionary biology - in other words, that which is taught in college and high schools. The idea that humans and chimps shared common ancestors (which seems to be a real problem for conservative Christians) does not depend on scientific theories of how the first cells arose. Really, this should be obvious, but everyone from Discovery Institute Fellow William Dembski to Judge Carnes to the Dover, PA school board seems to miss this point.
What this means is that when discussing how things could have evolved, we have to take note of the fact that modern evolutionary biology essentially starts with the assumption of a living population of cells - a primitive bacterium that already had a genome, transcription, translation, nutrient transporters, ion transporters, signal transduction, and gene regulation. Arguments about the sufficiency of natural selection to bring about the diversity of life we see today only have to deal with whether we can get from the structures and systems present in these early cells to the structures and systems present in today's living species. Researchers who work on issues of molecular evolution would argue that there are no holes in our understanding substantial enough to cast doubt on the idea that known evolutionary mechanisms could produce today's species diversity. This is the challenge intelligent design has to answer in its critique of evolutionary biology - the question is not could the bacterial flagellum arise from random protein subunits, but rather, could the flagellum have evolved from the machinery of a secretory system. No evidence presented by ID advocates has been able to show that this is impossible, while professional biologists argue that such a transition is fairly simple to explain with current concepts of molecular evolution. We have a reasonable understanding of how selectively advantageous mutations get fixed, we know many of the physical mechanisms of mutation in DNA, we have hundreds of examples of multi-functional proteins, as well as tremendous amounts of data on how mutations impact protein structure and function.
This misconception is so absurd, and yet it crops up again and again. You would think that before hearing arguments Judge Carnes would have actually looked at the biology textbook at issue and asked himself whether our understanding of the transition from non-life to life really has anything to do with most of the content of the book. That he didn't do so just shows how people's sympathy for conservative religion makes them approach evolution in a way that they would never consider valid for other scientific or scholarly fields.
"From nonlife to life is the greatest gap in scientific theory. There is less evidence supporting it than there is for other theories. It sounds to me like evolution is more vulnerable and deserves more critical thinking..."
Leaving aside the fact that it's absurd for someone with no biology training to assume that what he sees as gaps or problems in a complex scientific theory are due to a lack of critical thinking by professional scientists and not his own ignorance, let's focus on this conflation of origins of life research and evolutionary biology, which is one of the most common misconceptions that the public has regarding evolution.
What are the differences between the two scientific fields?
Modern evolutionary biology begins where Darwin began - with the assumption of an already existing population of living cells. It makes no claims about where those first cells came from - how the first proteins came into existence, how the genetic code arose, how transcriptional and translational machinery came into being (the machinery responsible for taking the information from DNA and turning it into protein), how we got information from DNA to RNA to protein, how a metabolism arose, how a cell membrane encapsulated a replicating genome, how phenotype got linked to genotype. All of these are questions that are outstanding in the field of prebiotic evolution, or, if you will, origins of life research. If you take a class in evolutionary biology in college or high school, or read a textbook on evolutionary biology, you do not get taught the modern science of prebiotic evolution. The text may briefly mention some current scientific ideas on the origins of life (it may even include a whole chapter on it), but the textbook does not focus on the detailed content or techniques of that field. Why? Because origins of life research is not the same thing as evolutionary biology, or neo-Darwinism, or whatever you want to call it. As a biologist who is very interested in prebiotic evolution (although I have not yet done research in this field), I have to admit that most of the questions I listed above are still wide open. Scientists aren't completely empty-handed, but the transition from non-life to life is still a big, fascinating scientific question. But this is not true of evolutionary biology.
It is important to note that logically evolutionary biology does not depend on the status of the field of prebiotic evolution. Whether natural selection is a major evolutionary mechanism, whether punctuated equilibrium is correct, whether ideas about genetic drift, speciation, neutral evolution, the molecular clock, or specific phlyogenetic relationships are correct does not at all depend on any conclusions or theories about how the first cells arose. God could have poofed those first cells into existence; it would make no difference. Darwin and every major biologist since then has been clear about this. Asserting that scientists can't explain how the first molecular machines arose does not weaken the status of natural selection or any aspect of modern evolutionary biology - in other words, that which is taught in college and high schools. The idea that humans and chimps shared common ancestors (which seems to be a real problem for conservative Christians) does not depend on scientific theories of how the first cells arose. Really, this should be obvious, but everyone from Discovery Institute Fellow William Dembski to Judge Carnes to the Dover, PA school board seems to miss this point.
What this means is that when discussing how things could have evolved, we have to take note of the fact that modern evolutionary biology essentially starts with the assumption of a living population of cells - a primitive bacterium that already had a genome, transcription, translation, nutrient transporters, ion transporters, signal transduction, and gene regulation. Arguments about the sufficiency of natural selection to bring about the diversity of life we see today only have to deal with whether we can get from the structures and systems present in these early cells to the structures and systems present in today's living species. Researchers who work on issues of molecular evolution would argue that there are no holes in our understanding substantial enough to cast doubt on the idea that known evolutionary mechanisms could produce today's species diversity. This is the challenge intelligent design has to answer in its critique of evolutionary biology - the question is not could the bacterial flagellum arise from random protein subunits, but rather, could the flagellum have evolved from the machinery of a secretory system. No evidence presented by ID advocates has been able to show that this is impossible, while professional biologists argue that such a transition is fairly simple to explain with current concepts of molecular evolution. We have a reasonable understanding of how selectively advantageous mutations get fixed, we know many of the physical mechanisms of mutation in DNA, we have hundreds of examples of multi-functional proteins, as well as tremendous amounts of data on how mutations impact protein structure and function.
This misconception is so absurd, and yet it crops up again and again. You would think that before hearing arguments Judge Carnes would have actually looked at the biology textbook at issue and asked himself whether our understanding of the transition from non-life to life really has anything to do with most of the content of the book. That he didn't do so just shows how people's sympathy for conservative religion makes them approach evolution in a way that they would never consider valid for other scientific or scholarly fields.
Thursday, December 15, 2005
Is evolution the cornerstone of experimental biology?
The chemist Philip Skell, an emeritus professor at Penn State and member of the National Academy of Sciences, wrote an opinion piece published in the August 29 issue of The Scientist (a subscription is required) titled "Why Do We Invoke Darwin? Evolutionary theory contributes little to experimental biology." I'll get to the substance of the piece in a minute, but the first thing to point out is the misleading title: Why do we invoke Darwin? Skell seems to count himself as a biologist, which he is not. He is a chemist. Perhaps the reactions he studies are relevant to biology, but he is not even a biochemist. As others have already pointed out around the web (like on The Panda's Thumb), Skell has no publications in a journal that deals at all with biology. A PubMed search turns up no articles, and I guarantee you that no scientist who is an authentic biologist or biochemist actually has zero citations in PubMed (unless it is a grad student or technician who doesn't have publications yet).
Skell is not a newcomer to the Intelligent Design controversy (check here, here, and here for starters). I'm not writing this to deal specifically with Skell, but with his general claim, which is heard over and over in anti-evolution circles, that everyday molecular biology/biochemistry/cell biology does not really use evolutionary concepts (another example can be found in this opinion article). The point these people are trying to make is that evolution is in fact not the cornerstone that biologists make it out to be, and that most modern biology could go on just fine without dogmatic invocations of evolution. (Skell calls these invocations just a "coda" or "gloss" on the substance of these papers, and says outright that evolution "does not provide a fruitful heuristic in experimental biology.")
So, what exactly do these critics mean when they say that experimental biology doesn't really need evolution? Obviously, most basic research in biochemistry and molecular biology is not aimed at addressing outstanding questions in evolutionary theory - like the mechanism(s) of speciation, the role of genetic drift, natural selection, and neutral evolution in evolutionary history - because those questions are part of the specific science of evolutionary biology. Biochemists work on, believe it or not, biochemistry, not evolutionary biology. As obvious as this point is, it's clear that Intelligent Design advocates and sympathizers don't get it. That's why ID advocate Michael Behe thinks that by showing the word evolution to be largely absent from biochemistry textbooks, he has demonstrated how superfluous evolution is to the discipline of biochemistry. Phil Skell follows a similar route, by claiming that "[in a review of the literature] I substituted for 'evolution' some other word - 'Buddhism,' 'Aztec cosmology,' or even 'creationism.' I found that the substitution never touched the paper's core." (Leaving the side that as a non-biologist Skell probably cannot actually follow the 'core' of your average biology paper in a journal like Nature, this assertion is simply false regarding the papers I read every day.)
So if biochemists, geneticists, and molecular biologists are not studying speciation, natural selection, or some other aspect of evolution, how does evolution figure into their work as a foundation, or as Skell puts it, a "fruitful heuristic"? The most dominant way evolution figures into basic experimental biology is through homology. Evolution is a complex theory that can't be summed up as a slogan, but if it could, that slogan would be "descent with modification" (and not, by the way, "survival of the fittest"). This slogan captures two important ideas in evolution - that all living organisms descended from a set of common ancestors, and that today's organisms are different from those ancestors.
Biochemists frequently attempt to identify important amino acids in proteins by comparing amino acid sequences of these proteins in a variety of organisms. Thinking in terms of common ancestry and natural selection, we predict that amino acids that are crucial for a particular function are conserved in homologous proteins in many different organisms, while those parts that aren't crucial can vary. Biochemists line up the sequences of a given protein from various organisms, and look for the unchanged amino acids. Those amino acids are predicted to be functionally important; these predictions can easily be tested by mutational experiments. (Take a look at at this example.)
I have an example from some experiments I did just last month. In yeast, there is a membrane protein called Ena5, which is predicted to be a "sodium ATPase" - meaning this protein pumps sodium across the cell membrane by "hydrolyzing ATP", that is, converting a molecule called ATP to a molecule called ADP. This protein is part of a general class of proteins called "P-type ATPases", which are membrane-embedded proteins that hydrolyze ATP in order to pump something across a membrane.
To my knowledge, nobody had actually tested Ena5 biochemically, but we were pretty confident about the prediction because Ena5 has a set of amino acid sequences that are the same or very close in all proteins of this class (each letter stands for an amino acid):
1)LDGES, 2)SDKTGTLT, 3)KGAFE, 4)MLTGD, 5)GDGVND (taken from Catty, et al.)
Ena5 consists of 1,091 amino acids, most of which which differ from other ATPases, but those 29 amino acids I listed are closely conserved. Why? Evolution explains why - these portions are functionally important, and thus natural selection preserves them. But it is important to note that this is not the only way to build a sodium pump; you can build one without the sequences I listed above. These particular sequences are conserved because an ancestral sodium pump just happened to be built a certain way, and from then on, natural selection preserved those sequences.
Using this idea, that natural selection preserves important residues, we had a pretty good idea that Ena5 was a sodium ATPase without even testing it. And sure enough, when I tested this protein's ability to hydrolyze ATP, it worked. (Reconstituting the actual sodium pumping activity is more complex experiment, but will probably be done if we follow up on this particular protein.) Using evolutionary reasoning, we can make predictions that are useful in the biochemical study of proteins. This type of reasoning is absolutely crucial to our understanding of human biology - we can do experiments in yeast that we can't do in humans, and without the study of homologs it would be nearly impossible to identify proteins with a given function in the human genome. Biochemists and geneticists do this all the time. This is not just gloss - without the concepts of evolution, these functional predictions would make absolutely no sense.
I've droned on enough, but this is just one example of how evolutionary reasoning is used in everyday biology. There are many others.
Skell is not a newcomer to the Intelligent Design controversy (check here, here, and here for starters). I'm not writing this to deal specifically with Skell, but with his general claim, which is heard over and over in anti-evolution circles, that everyday molecular biology/biochemistry/cell biology does not really use evolutionary concepts (another example can be found in this opinion article). The point these people are trying to make is that evolution is in fact not the cornerstone that biologists make it out to be, and that most modern biology could go on just fine without dogmatic invocations of evolution. (Skell calls these invocations just a "coda" or "gloss" on the substance of these papers, and says outright that evolution "does not provide a fruitful heuristic in experimental biology.")
So, what exactly do these critics mean when they say that experimental biology doesn't really need evolution? Obviously, most basic research in biochemistry and molecular biology is not aimed at addressing outstanding questions in evolutionary theory - like the mechanism(s) of speciation, the role of genetic drift, natural selection, and neutral evolution in evolutionary history - because those questions are part of the specific science of evolutionary biology. Biochemists work on, believe it or not, biochemistry, not evolutionary biology. As obvious as this point is, it's clear that Intelligent Design advocates and sympathizers don't get it. That's why ID advocate Michael Behe thinks that by showing the word evolution to be largely absent from biochemistry textbooks, he has demonstrated how superfluous evolution is to the discipline of biochemistry. Phil Skell follows a similar route, by claiming that "[in a review of the literature] I substituted for 'evolution' some other word - 'Buddhism,' 'Aztec cosmology,' or even 'creationism.' I found that the substitution never touched the paper's core." (Leaving the side that as a non-biologist Skell probably cannot actually follow the 'core' of your average biology paper in a journal like Nature, this assertion is simply false regarding the papers I read every day.)
So if biochemists, geneticists, and molecular biologists are not studying speciation, natural selection, or some other aspect of evolution, how does evolution figure into their work as a foundation, or as Skell puts it, a "fruitful heuristic"? The most dominant way evolution figures into basic experimental biology is through homology. Evolution is a complex theory that can't be summed up as a slogan, but if it could, that slogan would be "descent with modification" (and not, by the way, "survival of the fittest"). This slogan captures two important ideas in evolution - that all living organisms descended from a set of common ancestors, and that today's organisms are different from those ancestors.
Biochemists frequently attempt to identify important amino acids in proteins by comparing amino acid sequences of these proteins in a variety of organisms. Thinking in terms of common ancestry and natural selection, we predict that amino acids that are crucial for a particular function are conserved in homologous proteins in many different organisms, while those parts that aren't crucial can vary. Biochemists line up the sequences of a given protein from various organisms, and look for the unchanged amino acids. Those amino acids are predicted to be functionally important; these predictions can easily be tested by mutational experiments. (Take a look at at this example.)
I have an example from some experiments I did just last month. In yeast, there is a membrane protein called Ena5, which is predicted to be a "sodium ATPase" - meaning this protein pumps sodium across the cell membrane by "hydrolyzing ATP", that is, converting a molecule called ATP to a molecule called ADP. This protein is part of a general class of proteins called "P-type ATPases", which are membrane-embedded proteins that hydrolyze ATP in order to pump something across a membrane.
To my knowledge, nobody had actually tested Ena5 biochemically, but we were pretty confident about the prediction because Ena5 has a set of amino acid sequences that are the same or very close in all proteins of this class (each letter stands for an amino acid):
1)LDGES, 2)SDKTGTLT, 3)KGAFE, 4)MLTGD, 5)GDGVND (taken from Catty, et al.)
Ena5 consists of 1,091 amino acids, most of which which differ from other ATPases, but those 29 amino acids I listed are closely conserved. Why? Evolution explains why - these portions are functionally important, and thus natural selection preserves them. But it is important to note that this is not the only way to build a sodium pump; you can build one without the sequences I listed above. These particular sequences are conserved because an ancestral sodium pump just happened to be built a certain way, and from then on, natural selection preserved those sequences.
Using this idea, that natural selection preserves important residues, we had a pretty good idea that Ena5 was a sodium ATPase without even testing it. And sure enough, when I tested this protein's ability to hydrolyze ATP, it worked. (Reconstituting the actual sodium pumping activity is more complex experiment, but will probably be done if we follow up on this particular protein.) Using evolutionary reasoning, we can make predictions that are useful in the biochemical study of proteins. This type of reasoning is absolutely crucial to our understanding of human biology - we can do experiments in yeast that we can't do in humans, and without the study of homologs it would be nearly impossible to identify proteins with a given function in the human genome. Biochemists and geneticists do this all the time. This is not just gloss - without the concepts of evolution, these functional predictions would make absolutely no sense.
I've droned on enough, but this is just one example of how evolutionary reasoning is used in everyday biology. There are many others.
Thursday, December 08, 2005
It's official
So it's finally happened - today I defended my doctoral dissertation and I now have a PhD in biochemistry. This is no longer a grad student blog!
Blogging should continue next week after I recover a little...
Blogging should continue next week after I recover a little...
Tuesday, December 06, 2005
Kristof's NY Times column on science literacy
Nicolas Kristof has an interesting column in today's NY Times (subscription required - it's that new Times Select thing). He makes a point that's been made before (as Kristof points out, most famously in C.P. Snow's famous "Two Cultures" essay), but it's worth making again because we're still facing this problem. Kristof says that much of our culture's scientific illiteracy stems not just from bad teaching, but also from our culture's profound bias towards education in the humanities. In our culture, you sound horribly uneducated if you've never read Hamlet or Plato, but nobody cares if you don't understand the difference between a gene and a chromosome, or if you can't say what a molecule is.
For some examples, you can look at the National Science Foundation's "Science and Engineering Indicators" report, which includes a section looking at the public's understanding of science. Here are a few of the results:
- <30% of Americans understand the term molecule
- only ~43% understand that lasers do not work by focusing sound waves
- 50% do not know that the earth goes around the sun once a year
- <50% know that humans and dinosaurs did not live at the same time
[Added in edit: These stats remind me of one episode of the Tonight Show, where Leno went Jaywalking to a local college commencement. As the graduates walked off the stage, with their diplomas in hand, wearing cap and gown, Leno pulled some aside and asked them some really basic questions: how many moons does the earth have, what's three squared, how many times does the earth go around the sun, etc. And there were actually people who where way off - who the hell doesn't know that the earth has only one moon? Apparently some graduates of a community college in Burbank.]
There weren't many questions related to molecular biology, but I'm sure the numbers are just as dismal for biology questions, like what is the difference between a gene and a chromosome, do human or bacteria cells have nuclei, are proteins made of amino acids or nucleic acids, etc...
Kristof points out that our political leaders and the public are forced to confront science policy issues with major ethical ramifications, but how can they make sound judgments about say, genetic engineering of human embryos when they don't even know the basics about DNA?
As much as I love Shakespeare (and Joyce and Pynchon, and Aristotle and Kant, and on and on), my high school had us read way too much Shakespeare and learn much too little math. You had to have 4 years of English, but only two years of math and two years of science to graduate. This means that one could graduate from high school without any idea of what sine or cosine means, or what a limit, derivative or integral is (limits, etc.), and without any coverage of chemical bonds or basic Newtonian mechanics. On the other hand, graduates would have read Julius Caesar, Romeo and Juliet, Macbeth, Hamlet, and King Lear (although no Plato or Aristotle).
On top of the spotty high school science curriculum, college science courses for non-majors are not much better. At many schools, students can pick and choose a variety of survey courses whose content is quickly forgotten within a few years. These courses may not be the best way to foster scientific literacy.
For some examples, you can look at the National Science Foundation's "Science and Engineering Indicators" report, which includes a section looking at the public's understanding of science. Here are a few of the results:
- <30% of Americans understand the term molecule
- only ~43% understand that lasers do not work by focusing sound waves
- 50% do not know that the earth goes around the sun once a year
- <50% know that humans and dinosaurs did not live at the same time
[Added in edit: These stats remind me of one episode of the Tonight Show, where Leno went Jaywalking to a local college commencement. As the graduates walked off the stage, with their diplomas in hand, wearing cap and gown, Leno pulled some aside and asked them some really basic questions: how many moons does the earth have, what's three squared, how many times does the earth go around the sun, etc. And there were actually people who where way off - who the hell doesn't know that the earth has only one moon? Apparently some graduates of a community college in Burbank.]
There weren't many questions related to molecular biology, but I'm sure the numbers are just as dismal for biology questions, like what is the difference between a gene and a chromosome, do human or bacteria cells have nuclei, are proteins made of amino acids or nucleic acids, etc...
Kristof points out that our political leaders and the public are forced to confront science policy issues with major ethical ramifications, but how can they make sound judgments about say, genetic engineering of human embryos when they don't even know the basics about DNA?
As much as I love Shakespeare (and Joyce and Pynchon, and Aristotle and Kant, and on and on), my high school had us read way too much Shakespeare and learn much too little math. You had to have 4 years of English, but only two years of math and two years of science to graduate. This means that one could graduate from high school without any idea of what sine or cosine means, or what a limit, derivative or integral is (limits, etc.), and without any coverage of chemical bonds or basic Newtonian mechanics. On the other hand, graduates would have read Julius Caesar, Romeo and Juliet, Macbeth, Hamlet, and King Lear (although no Plato or Aristotle).
On top of the spotty high school science curriculum, college science courses for non-majors are not much better. At many schools, students can pick and choose a variety of survey courses whose content is quickly forgotten within a few years. These courses may not be the best way to foster scientific literacy.
Monday, December 05, 2005
Evolutionary Biologists aren't Humanities Professors
The latest issue of The New Republic has a review (subscription required) by Gertrude Himmelfarb of two recent edited volumes on evolution (by Edward Wilson and by James Watson).
Not surprisingly, the article exudes a typical neocon attitude towards this whole issue - sympathetic towards Creationism without endorsing it, and scornful of evolutionists for their elitism and arrogance. The main problem with articles like this though, is that it makes evolutionary biology look like it was one of the humanities. I'm not knocking the humanities (I majored in music as an undergrad), but debates in the natural sciences are completely different.
Himmelfarb starts out the article with something supposedly said to her by Julian Huxley (a biologist and grandson of the famous T.H. Huxley): "There is nothing new to say about evolution. Everything that needs saying has already been said. The theory is incontrovertible."
This is something I hope no scientist would say about any field of science where there is actual research going on! Himmelfarb says that was 1958, 5 years after Watson and Crick's double helix, and at a time when scientists were already recognizing the potential that molecular studies had for the field of evolution. (A good place to read about it is in the phenomenal book The Eighth Day of Creation.) Himmelfarb rightly goes on to point out how much has changed in evolutionary biology since that statement, but she has already made a biologist look dogmatic within the first paragraph of the article. (OK, maybe Huxley really did make himself look dogmatic.) Himmelfarb also includes a few dubious statements: "Natural selection, then, not evolution, was Darwin's claim to fame, evolution having achieved scientific status, so to speak, only by virtue of the mechanism that brought it about." Maybe I'm misreading her, but this looks like Himmelfarb is claiming that scientists only accepted evolution because they found natural selection convincing. She uses this to set up the next section of her article: "And this is still the heart of the debate today." Natural selection was accepted only later, and scientists in the 1870's accepted evolution fairly quickly, because of the evidence Darwin and others presented that was independent of the idea of natural selection.
I can't understand why Himmelfarb made that statement anyway, because in the same paragraph she states: "many secularists had reservations not about evolution but about natural selection." Who does she use as an example though? John Stuart Mill - not exactly a scientist. Basically, Himmelfarb makes a statement about why evolution "achieved scientific status, so to speak," says "this is still the heart of the debate today," and then completely ignores the science and writes about people who debated the issue's theological, philosophical and ethical issues. The moral and theological debate is interesting in itself, but it should not be confused with the scientific debate - evolutionary biology is not a discipline in the humanities. And because humanities debates, however interesting and valuable and relevant, are rarely ever decisively settled, Himmelfarb states that "Notwithstanding Julian Huxley, nothing has been settled." Even though I am appalled at the statement credited to Huxley ("it's all incontrovertible!"), that statement was about the science of evolution, and in that area, a hell of a lot has been settled. Professional evolutionary biology is one of the major foundations of modern biological research (the other foundations being, in my opinion, biochemistry [life is based in physics and chemistry], genetics [the transmission of biological traits], and molecular biology [the Central Dogma DNA -> RNA -> Protein]).
Himmelfarb hits the end of her piece with some incredibly hypocritical advice for scientists:
"A non-scientist may well stand in awe of the enormous achievements that they [Wilson and Watson] as individuals, and science in general, have to their credit. They have learned a great deal, and we have learned a great deal from them. But what they have evidently not learned is humility--an appreciation of the limits of science, of what science does not know and cannot know."
One could say the same about the critics of evolution - they are rarely humble enough to acknowledge the limits of their own non-technical knowledge when it comes to today's modern, technical, professional field of evolutionary biology.
There's another interesting article that came out this weekend. In the NY Times Week In Review section, there is an article that discusses ID's lack of acceptance in academia, even among those who would be considered the movement's natural allies. People are concluding what religious and non-religious scientists have been saying all along - ID is intellectually shoddy.
Not surprisingly, the article exudes a typical neocon attitude towards this whole issue - sympathetic towards Creationism without endorsing it, and scornful of evolutionists for their elitism and arrogance. The main problem with articles like this though, is that it makes evolutionary biology look like it was one of the humanities. I'm not knocking the humanities (I majored in music as an undergrad), but debates in the natural sciences are completely different.
Himmelfarb starts out the article with something supposedly said to her by Julian Huxley (a biologist and grandson of the famous T.H. Huxley): "There is nothing new to say about evolution. Everything that needs saying has already been said. The theory is incontrovertible."
This is something I hope no scientist would say about any field of science where there is actual research going on! Himmelfarb says that was 1958, 5 years after Watson and Crick's double helix, and at a time when scientists were already recognizing the potential that molecular studies had for the field of evolution. (A good place to read about it is in the phenomenal book The Eighth Day of Creation.) Himmelfarb rightly goes on to point out how much has changed in evolutionary biology since that statement, but she has already made a biologist look dogmatic within the first paragraph of the article. (OK, maybe Huxley really did make himself look dogmatic.) Himmelfarb also includes a few dubious statements: "Natural selection, then, not evolution, was Darwin's claim to fame, evolution having achieved scientific status, so to speak, only by virtue of the mechanism that brought it about." Maybe I'm misreading her, but this looks like Himmelfarb is claiming that scientists only accepted evolution because they found natural selection convincing. She uses this to set up the next section of her article: "And this is still the heart of the debate today." Natural selection was accepted only later, and scientists in the 1870's accepted evolution fairly quickly, because of the evidence Darwin and others presented that was independent of the idea of natural selection.
I can't understand why Himmelfarb made that statement anyway, because in the same paragraph she states: "many secularists had reservations not about evolution but about natural selection." Who does she use as an example though? John Stuart Mill - not exactly a scientist. Basically, Himmelfarb makes a statement about why evolution "achieved scientific status, so to speak," says "this is still the heart of the debate today," and then completely ignores the science and writes about people who debated the issue's theological, philosophical and ethical issues. The moral and theological debate is interesting in itself, but it should not be confused with the scientific debate - evolutionary biology is not a discipline in the humanities. And because humanities debates, however interesting and valuable and relevant, are rarely ever decisively settled, Himmelfarb states that "Notwithstanding Julian Huxley, nothing has been settled." Even though I am appalled at the statement credited to Huxley ("it's all incontrovertible!"), that statement was about the science of evolution, and in that area, a hell of a lot has been settled. Professional evolutionary biology is one of the major foundations of modern biological research (the other foundations being, in my opinion, biochemistry [life is based in physics and chemistry], genetics [the transmission of biological traits], and molecular biology [the Central Dogma DNA -> RNA -> Protein]).
Himmelfarb hits the end of her piece with some incredibly hypocritical advice for scientists:
"A non-scientist may well stand in awe of the enormous achievements that they [Wilson and Watson] as individuals, and science in general, have to their credit. They have learned a great deal, and we have learned a great deal from them. But what they have evidently not learned is humility--an appreciation of the limits of science, of what science does not know and cannot know."
One could say the same about the critics of evolution - they are rarely humble enough to acknowledge the limits of their own non-technical knowledge when it comes to today's modern, technical, professional field of evolutionary biology.
There's another interesting article that came out this weekend. In the NY Times Week In Review section, there is an article that discusses ID's lack of acceptance in academia, even among those who would be considered the movement's natural allies. People are concluding what religious and non-religious scientists have been saying all along - ID is intellectually shoddy.
Friday, December 02, 2005
Functional wiggle room
Sitting in seminars, I frequently hear interesting tidbits and details which contribute to a perspective that I think most biologists take for granted, but which is quite different from popular conceptions of what's going on in the cell. Recently, I heard a description of a fairly typical result of a yeast genetics experiment that reinforced for me how flexible protein function really is.
If you read internet discussions of evolution (especially discussions of whether the power of mutation and natural selection can account for the molecular structures of the cell), you can encounter debates over how frequently mutations are beneficial, or how likely it is, given a function, that a protein will evolve to have that function (discussed in the Behe and Snoke paper, which is actually in a professional journal), and more along those lines. Many biologists who work with genetically manipulable model organisms like yeast, fruit flies, and small nematodes (worms), would find that these debates often lack an intuitive perspective that comes from spending a lot of time making lots and lots of mutations in a gene or an organism and looking at the results.
In yeast, researchers have deleted every single gene in yeast (one at a time of course!) and now are working to delete every possible pair of genes. Many researchers have mutated nearly every residue in a protein and looked at the function of these mutations (look here for one example of many). People who do this kind of thing get feel for just how flexible and resilient protein function is.
Anyway, a recent speaker at a meeting I attended mentioned an interesting example of "multicopy suppression," which basically means this: you delete a gene (which gives you a yeast strain with a detectable defect), and then look for other genes that, when present at high levels, can suppress this defect. From these kinds of experiments, you can infer something about the function of the gene that suppresses the defect. There is a gene in yeast called KEX2, which produces a protein that resides in an internal cellular membrane (the Golgi). This protein's job is to cut other proteins at specific places; these cuts are important processing steps for proteins that are secreted from the cell, like alpha-factor (a yeast pheromone essential for mating - yes, yeast mate! try Google for more...). When you knock out KEX2, the yeast cells are defective in mating because alpha-factor is not correctly processed. There is no backup system, like a redundant duplicate gene - you just take out KEX2 and these cells cannot mate. (Actually, this is true only of those cells that secrete alpha-factor - the other yeast "gender" secretes the pheromone a-factor, which is not processed by Kex2 and these cells mate fine when you delete Kex2).
So here you have a protein with a very specific function, in a specific location - Kex2 resides in the Golgi and cleaves proteins very specifically after the double-amino acid sequences lysine-arginine or arginine-arginine. You knock it out, and its function is gone. But now here's the beauty of multi-copy suppression: you can take the protein Yps2, put multiple copies in a Kex-2-deleted yeast strain, and you overcome the mating defect. When I was new to yeast I thought these types of suppression screens were crazy - kind of like taking the spark plugs out of your car and seeing if you can make up for this by adding other parts at random (or even worse, taking away other parts at random! this works in yeast too but don't try it on your car...). But they often work spectacularly well, and this is a standard genetic technique.
What is Yps2? It's a protein that is anchored outside of the cell, to the cell wall - in other words, it's not in the same place as Kex2. Yps2 also cuts other proteins (it's a "protease", to use the jargon), but at less specific sites - it cuts after any lysine or arginine amino acid (unlike Kex2 which only cuts after the double-amino acid sequences mentioned above). Because of how this gene was discovered, it was thought that Yps2 and Kex2 had overlapping functions - that they both were involved in processing proteins like alpha-factor. The only problem is that Yps2 is located at the cell wall, not in the Golgi, and Yps2 is a more indiscriminate cutter. Furthermore, Yps2 could not overcome the mating defect of Kex2-deleted cells unless it was present in the cell at artificially high levels.
So what was interesting was that the speaker at the meeting presented evidence that Yps2 plays a role in cell-wall integrity, and seemed to suggest that the initial idea that Yps2 overlapped functionally with Kex2 was not correct. (By the way, these proteins do not appear to be closely related in terms of sequence similarity, and they belong to different protease classes - Kex2 is a serine protease, and Yps2 is an apartyl protease, for those interested in the technical details.) What this means is that when you knock out one protein (Kex2), another protein (Yps2) - in an entirely different cellular location, with a more indiscriminate cutting specificity - can be forced to adequately take over the function of the deleted protein.
This isn't a formal argument about evolutionary potential, but it just gives a hint of the wide functional flexibility that evolution has to work with. In this experiment researchers artificially kept Yps2 levels high to cover the defect, but protein expression levels can also be altered in nature through mutation. There are many, many more examples of this type of thing, and it is the intuition growing out of this background that explains why the yeast biologists I know give little credence to the claims of evolution's critics who argue that small, gradual mutations cannot eventually produce major innovation in the cell.
If you read internet discussions of evolution (especially discussions of whether the power of mutation and natural selection can account for the molecular structures of the cell), you can encounter debates over how frequently mutations are beneficial, or how likely it is, given a function, that a protein will evolve to have that function (discussed in the Behe and Snoke paper, which is actually in a professional journal), and more along those lines. Many biologists who work with genetically manipulable model organisms like yeast, fruit flies, and small nematodes (worms), would find that these debates often lack an intuitive perspective that comes from spending a lot of time making lots and lots of mutations in a gene or an organism and looking at the results.
In yeast, researchers have deleted every single gene in yeast (one at a time of course!) and now are working to delete every possible pair of genes. Many researchers have mutated nearly every residue in a protein and looked at the function of these mutations (look here for one example of many). People who do this kind of thing get feel for just how flexible and resilient protein function is.
Anyway, a recent speaker at a meeting I attended mentioned an interesting example of "multicopy suppression," which basically means this: you delete a gene (which gives you a yeast strain with a detectable defect), and then look for other genes that, when present at high levels, can suppress this defect. From these kinds of experiments, you can infer something about the function of the gene that suppresses the defect. There is a gene in yeast called KEX2, which produces a protein that resides in an internal cellular membrane (the Golgi). This protein's job is to cut other proteins at specific places; these cuts are important processing steps for proteins that are secreted from the cell, like alpha-factor (a yeast pheromone essential for mating - yes, yeast mate! try Google for more...). When you knock out KEX2, the yeast cells are defective in mating because alpha-factor is not correctly processed. There is no backup system, like a redundant duplicate gene - you just take out KEX2 and these cells cannot mate. (Actually, this is true only of those cells that secrete alpha-factor - the other yeast "gender" secretes the pheromone a-factor, which is not processed by Kex2 and these cells mate fine when you delete Kex2).
So here you have a protein with a very specific function, in a specific location - Kex2 resides in the Golgi and cleaves proteins very specifically after the double-amino acid sequences lysine-arginine or arginine-arginine. You knock it out, and its function is gone. But now here's the beauty of multi-copy suppression: you can take the protein Yps2, put multiple copies in a Kex-2-deleted yeast strain, and you overcome the mating defect. When I was new to yeast I thought these types of suppression screens were crazy - kind of like taking the spark plugs out of your car and seeing if you can make up for this by adding other parts at random (or even worse, taking away other parts at random! this works in yeast too but don't try it on your car...). But they often work spectacularly well, and this is a standard genetic technique.
What is Yps2? It's a protein that is anchored outside of the cell, to the cell wall - in other words, it's not in the same place as Kex2. Yps2 also cuts other proteins (it's a "protease", to use the jargon), but at less specific sites - it cuts after any lysine or arginine amino acid (unlike Kex2 which only cuts after the double-amino acid sequences mentioned above). Because of how this gene was discovered, it was thought that Yps2 and Kex2 had overlapping functions - that they both were involved in processing proteins like alpha-factor. The only problem is that Yps2 is located at the cell wall, not in the Golgi, and Yps2 is a more indiscriminate cutter. Furthermore, Yps2 could not overcome the mating defect of Kex2-deleted cells unless it was present in the cell at artificially high levels.
So what was interesting was that the speaker at the meeting presented evidence that Yps2 plays a role in cell-wall integrity, and seemed to suggest that the initial idea that Yps2 overlapped functionally with Kex2 was not correct. (By the way, these proteins do not appear to be closely related in terms of sequence similarity, and they belong to different protease classes - Kex2 is a serine protease, and Yps2 is an apartyl protease, for those interested in the technical details.) What this means is that when you knock out one protein (Kex2), another protein (Yps2) - in an entirely different cellular location, with a more indiscriminate cutting specificity - can be forced to adequately take over the function of the deleted protein.
This isn't a formal argument about evolutionary potential, but it just gives a hint of the wide functional flexibility that evolution has to work with. In this experiment researchers artificially kept Yps2 levels high to cover the defect, but protein expression levels can also be altered in nature through mutation. There are many, many more examples of this type of thing, and it is the intuition growing out of this background that explains why the yeast biologists I know give little credence to the claims of evolution's critics who argue that small, gradual mutations cannot eventually produce major innovation in the cell.
Thursday, December 01, 2005
Progress in science?
I'm currently re-reading Philip Kitcher's excellent book Abusing Science: The Case Against Creationism. Although this book came out some years before the evolution of that new form of Creationism called Intelligent Design, this book is nonetheless still very relevant to the arguments heard in the creation/evolution debate today.
But, there's one thing that always rubs me the wrong way when I read descriptions of science by philosophers (Kitcher is a philosopher of science; in fact he's my favorite philosopher of science - I highly recommend Science, Truth, and Democracy, and In Mendel's Mirror). Philosophers are often so concerned about debunking a naive scientific triumphalism that can be found in some scientists' writings, that I think they distort the picture of scientific progress somewhat.
Here are some quotes from Kitcher (p. 34) "But scientists often forget the fallibility of their enterprise. This is not just absentmindedness or wishful thinking. During the heyday of a scientific theory, so much evidence may support the theory, so many observational clues may seem to attest to its truth, that the idea that it could be overthrown appears ludicrous... Trained biochemists will talk quite naturally of seeing large molecules, and it is easy to overlook the fact that they are presupposing a massive body of theory in describing what they "see"... No theory in the history of science enjoyed a more spectacular career than Newton's mechanics. Yet Newton's ideas had to give way to Einstein's... [Scientists'] enthusiastic assertions that evolution is a proven fact can be charitably understood as the claim that the (admittedly inconclusive) evidence we have for evolutionary theory is as good as we ever obtain for any theory in any field of science."
As a caveat, I may be reading more into this than Kitcher intended, but I'm going to get on my soapbox anyway. The impression that readers might draw from this passage is that theories like relativity, evolution, quantum mechanics, plate tectonics, thermodynamics, etc. can go the way of phlogiston and other discarded theories that you only hear about in a history of science class. However ludicrous it may seem today, a future generation may look back and see how wrong we were (which is exactly what intelligent design advocates believe). Kitcher's response seems to be (in a later part of the chapter, not the passage I quoted) that yes, these theories may go the way of the humour theory of human physiology, but they are the most well-justified theories we have by the facts available to us today.
I don't think that does our current ideas justice. Yes, Newtonian physics had to make way for relativistic physics, but essentially every college science major begins physics with a whole semester of nothing but Newtonian mechanics, and then another one devoted essentially to Maxwell's theories of electromagnetism.
On the other hand, you don't start freshman chemistry with a whole semester on phlogiston.
There's a difference between these two examples that philosophers frequently downplay or leave out in their descriptions, and I think it gives people the wrong impression.
I'll make a prediction: just as we still teach a lot of Newtonian physics, 100 years after Einstein's miraculous year and nearly 80 years after the first development of quantum mechanics, we will also, 100 years from now, still teach basic evolution to every college biology major, we will still teach the basic ideas of genetics and molecular biology, and we will still teach the basic ideas of plate tectonics. These theories may be superceded by radically different ideas; still, like Newtonian mechanics, the basics of evolution, molecular biology, and plate tectonics will still be there and relevant. No one should be under any illusion that evolutionary theory will look like phlogiston in 200 years. Science does make progress, and barring that the laws of physics miraculously change at 12:05 am on January 12, 2087, our most solid ideas in current science are destined to stick around, in some form.
But, there's one thing that always rubs me the wrong way when I read descriptions of science by philosophers (Kitcher is a philosopher of science; in fact he's my favorite philosopher of science - I highly recommend Science, Truth, and Democracy, and In Mendel's Mirror). Philosophers are often so concerned about debunking a naive scientific triumphalism that can be found in some scientists' writings, that I think they distort the picture of scientific progress somewhat.
Here are some quotes from Kitcher (p. 34) "But scientists often forget the fallibility of their enterprise. This is not just absentmindedness or wishful thinking. During the heyday of a scientific theory, so much evidence may support the theory, so many observational clues may seem to attest to its truth, that the idea that it could be overthrown appears ludicrous... Trained biochemists will talk quite naturally of seeing large molecules, and it is easy to overlook the fact that they are presupposing a massive body of theory in describing what they "see"... No theory in the history of science enjoyed a more spectacular career than Newton's mechanics. Yet Newton's ideas had to give way to Einstein's... [Scientists'] enthusiastic assertions that evolution is a proven fact can be charitably understood as the claim that the (admittedly inconclusive) evidence we have for evolutionary theory is as good as we ever obtain for any theory in any field of science."
As a caveat, I may be reading more into this than Kitcher intended, but I'm going to get on my soapbox anyway. The impression that readers might draw from this passage is that theories like relativity, evolution, quantum mechanics, plate tectonics, thermodynamics, etc. can go the way of phlogiston and other discarded theories that you only hear about in a history of science class. However ludicrous it may seem today, a future generation may look back and see how wrong we were (which is exactly what intelligent design advocates believe). Kitcher's response seems to be (in a later part of the chapter, not the passage I quoted) that yes, these theories may go the way of the humour theory of human physiology, but they are the most well-justified theories we have by the facts available to us today.
I don't think that does our current ideas justice. Yes, Newtonian physics had to make way for relativistic physics, but essentially every college science major begins physics with a whole semester of nothing but Newtonian mechanics, and then another one devoted essentially to Maxwell's theories of electromagnetism.
On the other hand, you don't start freshman chemistry with a whole semester on phlogiston.
There's a difference between these two examples that philosophers frequently downplay or leave out in their descriptions, and I think it gives people the wrong impression.
I'll make a prediction: just as we still teach a lot of Newtonian physics, 100 years after Einstein's miraculous year and nearly 80 years after the first development of quantum mechanics, we will also, 100 years from now, still teach basic evolution to every college biology major, we will still teach the basic ideas of genetics and molecular biology, and we will still teach the basic ideas of plate tectonics. These theories may be superceded by radically different ideas; still, like Newtonian mechanics, the basics of evolution, molecular biology, and plate tectonics will still be there and relevant. No one should be under any illusion that evolutionary theory will look like phlogiston in 200 years. Science does make progress, and barring that the laws of physics miraculously change at 12:05 am on January 12, 2087, our most solid ideas in current science are destined to stick around, in some form.
Sunday, November 27, 2005
Welcome
Why am I doing this?
This little blog will ostensibly be about biology - especially the biology I know best, genomics, biochemistry, molecular biology and genetics. While I intend to highlight and comment on developments in professional research in a way that's hopefully entertaining and enlightening, I also plan to write about areas where biology leaves the professional arena and touches all of our lives. Creation...er...Intelligent Design/evolution, stem cell research, science funding, the environment, and whatever else strikes my fancy.
In other words, I hope to sometimes comment on things I know nothing about (public policy), but in the context of something I know a lot about (some aspects of biology).
There are great blogs out there, but I think there is still a great need out there for working scientists to 1) communicate what's happening in their highly technical world to the taxpayers who are paying their salaries and research budgets, and 2) add their perspective to current debates going on in our society.
It's going to take some effort to get this blog going and get the wrinkles out, but ultimately the goal is to provide a worthwhile post at least twice a week. I may hit the twice-a-week goal fairly soon, but the worthwhile post goal might take months to years, so keep checking back once in awhile to see if you find this blog interesting. If you do find it interesting, spread the word! If not, you can call me names in the comments section.
Who am I? I am 1.5 weeks from defending my doctoral thesis in biochemistry at the University of Rochester, in Rochester, NY. (So why the hell are you starting this blog now, you ask? Good question. Maybe because I'd rather be doing anything other than studying!) My specialty at this point is "functional and structural genomics of yeast membrane proteins." Meaning, I like to follow the literature in genomics, yeast, and the biochemical and biophysical study of membrane proteins. In a short while, I'll be starting a postdoctoral fellowship in the Center for Genome Science at Washington University, where I'll continue in yeast genomics, but with a focus on gene regulatory networks, especially networks that regulate the cell cycle.
I am also married with one daughter and two more on the way. (Yes, two, and yes, I'm defending my thesis, expecting twins, moving halfway across the country, and starting a new job in a new field all within two months. So why am I starting this blog now, you ask again?) We are ex-Mormon, and, having left a faith espousing a fairly fundamentalist theology, I am very hypersensitive to any kind of tacit government endorsement of a theological perspective (conservative Christianity) which I have thoroughly rejected. As a warning, this may come across in some of my posts, especially those dealing with the creation/evolution controversy.
So, this is officially post number 1 - I promise in the future it will get more interesting, mainly because it won't be about me anymore.
This little blog will ostensibly be about biology - especially the biology I know best, genomics, biochemistry, molecular biology and genetics. While I intend to highlight and comment on developments in professional research in a way that's hopefully entertaining and enlightening, I also plan to write about areas where biology leaves the professional arena and touches all of our lives. Creation...er...Intelligent Design/evolution, stem cell research, science funding, the environment, and whatever else strikes my fancy.
In other words, I hope to sometimes comment on things I know nothing about (public policy), but in the context of something I know a lot about (some aspects of biology).
There are great blogs out there, but I think there is still a great need out there for working scientists to 1) communicate what's happening in their highly technical world to the taxpayers who are paying their salaries and research budgets, and 2) add their perspective to current debates going on in our society.
It's going to take some effort to get this blog going and get the wrinkles out, but ultimately the goal is to provide a worthwhile post at least twice a week. I may hit the twice-a-week goal fairly soon, but the worthwhile post goal might take months to years, so keep checking back once in awhile to see if you find this blog interesting. If you do find it interesting, spread the word! If not, you can call me names in the comments section.
Who am I? I am 1.5 weeks from defending my doctoral thesis in biochemistry at the University of Rochester, in Rochester, NY. (So why the hell are you starting this blog now, you ask? Good question. Maybe because I'd rather be doing anything other than studying!) My specialty at this point is "functional and structural genomics of yeast membrane proteins." Meaning, I like to follow the literature in genomics, yeast, and the biochemical and biophysical study of membrane proteins. In a short while, I'll be starting a postdoctoral fellowship in the Center for Genome Science at Washington University, where I'll continue in yeast genomics, but with a focus on gene regulatory networks, especially networks that regulate the cell cycle.
I am also married with one daughter and two more on the way. (Yes, two, and yes, I'm defending my thesis, expecting twins, moving halfway across the country, and starting a new job in a new field all within two months. So why am I starting this blog now, you ask again?) We are ex-Mormon, and, having left a faith espousing a fairly fundamentalist theology, I am very hypersensitive to any kind of tacit government endorsement of a theological perspective (conservative Christianity) which I have thoroughly rejected. As a warning, this may come across in some of my posts, especially those dealing with the creation/evolution controversy.
So, this is officially post number 1 - I promise in the future it will get more interesting, mainly because it won't be about me anymore.
Subscribe to:
Posts (Atom)


